Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA7YD02FM1
Length(NT) : 650
Best Gene Model Blast : Link to GSTUMT00000508001 E-value : 1e-140
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001594213.1| Score: 415 E_value: 3e-61
KEGG Definition: sorting nexin SNX11
Accession: aor:AO090020000309 Score: 417 E_value: 3e-61
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2527 Score: 247 E_value: 4e-22
PFAM Definition: PX, PX domain. PX domains bind to phosphoinositides..
Pfam Number: pfam00787 Score: 217 E_value: 1e-18
Swissprot: Q2U4K2|SNX3_ASPOR

Sequence:
>SY0AAA7YD02FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCAGCAACAAAAACGACAGC
AACAGAATGCAAGCCCCGATCCAGTCTTCCCGAGCTCAGAGCTTCGACGA
AATTTACGGACCTCCAGAAAATTTCCTGGAAATAGAGGTCAAAAATCCGC
AGACGCACGGGTTTGGGAGGAAGATGTATACGGATTATGAGGTCGTTTGT
CGTACGAACATTCCGGCATTCAAGGTAAATTGCCTTCTCTCCCACCCGTT
TCTTTTCTTTGTTCTTTTTTTTTCGTGGGATGGGAAAACTAAATGGATTA
CTATCGCTGCCGTTTTTACCATAATTATAGCTCAAAGCCTCTAGCGTCCG
ACGTAGGTACAGCGACTTTGAACACTTCCGCGACATACTAGAGCGGGAGT
CCTCGCGCGTCACCATCCCCCCCTTGCCTGGGAAAGTCTTCACGAACAGG
TTCTCCGACGACGTCATTGAGCACCGCCGTGAAGGGTTGCAGAGGTTCCT
GCAAATTGTCGTTGGCCACCCACTGCTCCAGACTGGAAGCAAGGTTTTGG
CGTCGTTTGTCCAAGACCCGAATTGGGATCGTACGAGTTGGTCGATTTAA
TGGGCACTAAAGTATTGTGGGGCGTTTGTGCATGCATGGTTTTTGTGGGT

Sequences in the Contig:

SY0AAA7YD02FM1