Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA7YC14FM1
Length(NT) : 473
Best Gene Model Blast : Link to GSTUMT00009327001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001217540.1| Score: 291 E_value: 4e-25
KEGG Definition: hypothetical protein [EC:3.1.13.-]; K03679 RNA-binding protein Rrp4 and related proteins
Accession: ani:AN3426.2 Score: 288 E_value: 5e-25
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG3013 Score: 164 E_value: 9e-13
PFAM Definition: Tymo_45kd_70kd, Tymovirus 45/70Kd protein. Tymoviruses are single stranded RNA viruses. This family includes a protein of unknown function that has been named based on its molecular weight. Tymoviruses such as the ononis yellow mosaic tymovirus encode only three proteins. Of these two are overlapping this protein overlaps a larger ORF that is thought to be the polymerase..
Pfam Number: pfam03251 Score: 125 E_value: 3e-08
Swissprot: Q09704|RRP4_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAA7YC14FM1
TTGGGCGATGGTTAGGTGGAATGTCAGGGTCAAGTCGCATATCGTCACGC
TAGAGGCTGCGAACGGGGCTGGGGAGGTGGATGTGATATTGGGCGTCAAC
GGCTACGTGTGGGTTTCCAAAAAGGTTACGTTGCAGGCTCCCCCCGGCGG
CGAGAGCATCACTCGGTTGGAGGAGGAGGCGAGCGAGGCCATCTACTCCA
ACGTGAATGAGGATATCGCCCCCGTTACCCGCAGGGAGATCGCCAGGGTA
GGGAACTGTGTTAGGGCGATGGTTAGGTGGAATGTCAGGGTTGACGAGGA
GGTCCTGAATGCCGTGTATCTGTCCGCACTGGAGCTCGAGGAGATGGGGT
TCACAGAGGAGGGCGGTTCCAGCAATGGGCCGGAGTGTCTGGAGGGGGAG
GTTGGGAGAAGAGCTGTGGAGGCTGGGATGGAACGGGTTAGGGAGGCTAA
TTCGAAGGCTAGGGGAATGGTTG

Sequences in the Contig:

SY0AAA7YC14FM1