Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA7YB15FM1
Length(NT) : 563
Best Gene Model Blast : Link to GSTUMT00000604001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_02216
Accession: ref|XP_001596000.1| Score: 841 E_value: 1e-88
KEGG Definition: hypothetical protein
Accession: fgr:FG09238.1 Score: 836 E_value: 2e-88
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA7YB15FM1
TTGGGGCGAGGGAAGGACAACGATCCCTGGAGGACAAGGGACCATGTGGA
CTACGCTTTTGCAAATGGGCGAGCTTGTTGACACAGCAAACCGGGTATTT
GACCCTGCGGAAACCCGGATTTTTGTTACCCACGCTTCACCAGCAAGGGA
GGGTTTGCTGAATCAATTGTCGGTTACTCTGAAGGCGGATTTCTCGATAT
CCGCTGGATTACATTTCCGGTATGGGAGCTCATACAACGAGTTCAGTGTA
AACCCAACTCTGGATCATTATAGGGGCAAGCTAGCCTCGTCGAAAGCATC
TTTCAATGATGTTTGGGAAACCGTCAAGGGTGAGGTCCTGCCCGCCGTTC
AGCAAAACGAAGCTCAGCACGCACTCTTGAATAATGCCTTGGATATCGTA
GAGAAGATGCCCACGAGCGCCAACGGCGGCAACCCGTTTGGTGGTCCGGC
ATCAAACACTGCTCCTGGAGCTGGGCAAGTCGATGAATCTGCCTTCAAGA
ATATGTGGAATTTCAACTTGGCAGACGCTGCATTTGGCTGGCTTGTTCTA
GAGGTTGAGGGTG

Sequences in the Contig:

SY0AAA7YB15FM1