Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA7YA24FM1
Length(NT) : 523
Best Gene Model Blast : Link to GSTUMT00004207001 E-value : 2e-83
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_09742
Accession: ref|XP_001800029.1| Score: 159 E_value: 1e-09
KEGG Definition: predicted protein
Accession: aor:AO090003001243 Score: 151 E_value: 5e-09
KOG Definition: No Hit Found
PFAM Definition: DUF77, Domain of unknown function DUF77. Domain of unknown function. The crystal structure of two of these members shows that this domain has a ferredoxin like fold and is likely to exists as at least homodimers. Sulphate ions are are located at the dimer interfaces, which are thought to confer additional stability. Although the function of this domain remains to be identified, its structure suggests a role in protein-protein interactions possibly regulated by the binding of small-molecule ligands..
Pfam Number: pfam01910 Score: 130 E_value: 9e-09
Swissprot: Q8J1F7|ECM15_ASHGO

Sequence:
>SY0AAA7YA24FM1
TTGGCTCGGGTGATTGGCCAGGCTCATTCTATGCTCCATGCACAGGGTAT
CTCGAGGGTGCACACCGATATCCGTATAGGAAGCAGGACCGATAAACAAC
AAACTATGCAAGATAAGGTGGCTTCGGTGGAGAAGCTCGCACGAGATCAG
GAGAAATAAACGGCTATTGGACCTCATTATTTATTCTCCCGGCCAACAGC
AATTTCCCACAAATGTGTACTCGGGTAGTGGAATAGATTTCATAAACTGT
TTGGAGGATATCGAGAAGGGGAATGAAAAAAACGATCGTCGTGAGGCCAA
TCCAAACCTAACCCTACGCTTGTCTATTCGAAACCCAGCCAGAGGGAATA
AATATCGAACGAGAGGATCAATTACCGTGGCACCCTTTTAATTGCATCGC
CGCTGGTTGATATTGTTCCAGGGGTTCGCTCTGAGCTCCCGTTACCACTG
CTTTGTGGACTGTGCGTTCCGGAGAAGTTGACAGTCCGCGAGACAGTTCT
GTTGGCTGGAGCACAGCTGTGTC

Sequences in the Contig:

SY0AAA7YA24FM1