Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA6YN08FM1
Length(NT) : 641
Best Gene Model Blast : Link to GSTUMT00006768001 E-value : 2e-89
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein PICST_33949
Accession: ref|XP_001386755.2| Score: 168 E_value: 2e-10
KEGG Definition: predicted protein
Accession: pic:PICST_33949 Score: 168 E_value: 9e-11
KOG Definition: No Hit Found
PFAM Definition: SUA5, SUA5 domain. The function of this domain is unknown, it is found in Saccharomyces cerevisiae SUA5 and its relatives. It is found to the C-terminus of pfam01300.
Pfam Number: pfam03481 Score: 179 E_value: 3e-14
Swissprot: P32579|SUA5_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0009060 = Biological process: aerobic respiration

Sequence:
>SY0AAA6YN08FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGCAAAGAACCTTAACGGCA
AAGTTGGTATTCTCCGAACGCGCACTTGGGAAGATGGCATTGGAGAGCTC
ACGCTGGGCCGCTTGAAATACGAGAGCAACAATGTTAAGAGCGAGTTTTG
TGGAAATAAGGGCATTAGTGGACTTACTGTTACCGAGAGGGATCTGGGCA
AGGGCGGGGAGGAGATTGGTCGCAGGCTGTTTGCTGCGCTAAGGGAGTTG
GATGATGAGGGGGTTGATGTTATCCACGTTGAGGGGATCGAGGAGGTGCT
TGAGGGGTTGGCGGTTATGAATCGGTTGAGGAAGGCGGCAAGTGTGGTTG
TGAGGAAGGTAGAGTAAACTTGCACGTCAGTCTCTAGAGTAGAGATGGGA
TAGAGGAGGATGAAAAAAGTTTTTAAAAAATTGTTTACGTTAATGGTTTG
TCGCTGGGTTTGCGCGTTCGGCAACTCCGCTCCCTCTCTCCTTCACTTTA
TCACCGATACACTAGACGGGTGGAGCCCGATGCAGCCTGCTTCCTTTTTA
AAAAGAAGATCCCTAGACCAATTTCTCTTTTTTTTCCTTCGTTTCATCCG
GTGGCATGGAATTTCTCAGTGCCTGATTTACCCTATGGCGT

Sequences in the Contig:

SY0AAA6YN08FM1