Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA6YK15FM1
Length(NT) : 731
Best Gene Model Blast : Link to GSTUMT00008513001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: protein ycaC
Accession: ref|XP_001209389.1| Score: 596 E_value: 5e-60
KEGG Definition: amidases related to nicotinamidase
Accession: aor:AO090001000095 Score: 579 E_value: 2e-58
KOG Definition: No Hit Found
PFAM Definition: Isochorismatase, Isochorismatase family. This family are hydrolase enzymes..
Pfam Number: pfam00857 Score: 191 E_value: 1e-15
Swissprot: P21367|YCAC_ECOLI
Gene Ontology:
GO:0005624 = Cellular component: membrane fraction

Sequence:
>SY0AAA6YK15FM1
TTGGGAGGTGCGCCCCAGATCACACGCAATCATATCTTTCCATTGATCAA
GATATCCGAAACGGGAGCAAGCGATATGTACTTCCCAATATCAGTTCTCA
CCCTTCTCGCGGCCCTAACTTTGCCGTTCACAGCCCAAGGTATGCCTCCG
AGAGCCAAACCCCAAGAGAGGAAACGATACGGCACTGACGACATGTAGCG
AGCGACCAAACTTTCACTCGGCTCAGGAAGAACGACACCGTTTTTCTTGT
TGTTGACCATCAGCTTGGTTTGTTCTCTCTTGTCCGGGACTTCGCGCCAG
ACCAATACAGGAACAACATCCTTGCACATGCTGCTCTCCCGAAAGTGTTC
AACATTCCGACCATCTTGACTACGAGTGCCGAGACTGGGCCCAATGGACC
ACTTCCGCGGGAGATCGTCGAGATACATAAAGGGGCTCCCTTCATCAAGC
GTAATGGTGAAGTCAATGCTTGGGATAATGCTGATTTCCGCGCTGCTGTC
AAAGCTACGGGGAAGAAACAAATTGTTCTTGCTGGCATCACAACCGACGT
GTGCACTGCTTTCCTTGCCCTCTCTCTGAGGGCCGAGGAATATGAGGTTT
TTGCCAATTCTGACGCAAGCGGAACATTCGATCAACGGCTCGCGGACGAA
GCCAACGACCGTATGAGAGCTGCCGGTGTTACCACCATGGGAATGTTTGC
GATTTCGATGGATCTCATGAGAGACTGGAGA

Sequences in the Contig:

SY0AAA6YK15FM1