Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA6YI24FM1
Length(NT) : 451
Best Gene Model Blast : Link to GSTUMT00001701001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Npt1p
Accession: gb|AAN74808.1| Score: 481 E_value: 4e-47
KEGG Definition: hypothetical protein
Accession: fgr:FG00269.1 Score: 474 E_value: 1e-46
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG2511 Score: 268 E_value: 7e-25
PFAM Definition: NAPRTase, Nicotinate phosphoribosyltransferase (NAPRTase) family. Nicotinate phosphoribosyltransferase (EC:2.4.2.11) is the rate limiting enzyme that catalyses the first reaction in the NAD salvage synthesis. This family also includes Pre-B cell enhancing factor that is a cytokine. This family is related to Quinolinate phosphoribosyltransferase pfam01729..
Pfam Number: pfam04095 Score: 163 E_value: 1e-12
Swissprot: Q9UTK3|NPT1_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAA6YI24FM1
TTGGCGCCTGACACAGGCGTTTCCGACCGTATGGCGAGTGAAGAGAATGG
GGGGTTGGAGCAAAATGGTGACGTGAGGATAGACATCAAAGGCAAATGGG
TGGAAACGATGCTCTACGAGATTCCATTACTGGTTCTAGTTAGCGAGGCG
TACTTTAAGTTCTCCAACACGGATTGGAACTACGAAGGCCAGGAGGAGAA
GGCGTTTGCAAAGGGCATGCAGCTCCTGGAGAATGGATGTTTGCTATCGG
AGTTTGGGACGAGGCGGCGAAGGAGTTATCATACCCAAGAACTTGTATTG
AATGGATTGGTTCGTGCGATGGCGCATTATGAGAAAAGTGGGGGAAGGAA
GGGCAAATTATCGGGAACCAGCAATGTACATTTTGCTCATAGGATGGGAC
TCAATCCTATCGGAACTGTTGCGCACGAATGGTTTATGGGCATTGCCGCA
A

Sequences in the Contig:

SY0AAA6YI24FM1