Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA6YG06FM1
Length(NT) : 515
Best Gene Model Blast : Link to GSTUMT00008818001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001265174.1| Score: 208 E_value: 2e-15
KEGG Definition: hypothetical protein; K04802 proliferating cell nuclear antigen
Accession: ani:AN0415.2 Score: 196 E_value: 3e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA6YG06FM1
TTGGAGAGCTTGGAGCCTGCCTATGGTAGCCAGCGGGAAGCGACCATCTC
ACTGCCTTCACGATCCCTATGGAGTCAATCGTTTTCGCAAATTCACCTCT
TGCCGAGTACCTTGAAGGAAATGGTGAGAGCGAAGCGTCCTGGGGCATAG
AACTATCGGGTCCGGTGCCGGCAAAGGAGAGTCAGCCAATATTCGCTCCA
CCACTGACGTCTATTACCGGTCGTTTCAGGAAAAAGGGGTTGAAGCCCTT
GAAGTTGAGCGATCCCAGTTGGAGCCGAAAGGCGAAGTTCTACGAATTCT
TTTCGAGAGTTGTCGATTCGAGATTGAGCAGAAACGAGAATTCCAAGTTC
CTCGAACGCTTTCGTTATATTATTGTCGCATCGCAGCTTTTGAACGAACA
TGTAAACGTCTCCCATTATGATCGGAAATCCGACCCAGATCTGTTTTCTC
TCGATGAGGTAACGTCGACAGATATCTTTGGCCCACAATATGCAAAAAGC
ATATATTGGGCCGGT

Sequences in the Contig:

SY0AAA6YG06FM1