Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA6YC15FM1
Length(NT) : 485
Best Gene Model Blast : Link to GSTUMT00000025001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: sterol o-acyltransferase (APE2), putaitve
Accession: ref|XP_001265065.1| Score: 488 E_value: 6e-48
KEGG Definition: hypothetical protein
Accession: ani:AN4208.2 Score: 485 E_value: 7e-48
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG0380 Score: 305 E_value: 4e-29
PFAM Definition: No Hit Found
Swissprot: Q9UU82|AREH2_SCHPO
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane
GO:0004772 = Molecular function: sterol O-acyltransferase activity

Sequence:
>SY0AAA6YC15FM1
TTGGGGAGTGGATATATGCTTCAGCACGTGCTGCAGGCGGTCTGGTTAGC
GGGCTGGGTACACCTCCCGTTTCATCTGGAGTGGCAATGGACTCATCAGG
TGTTTTTTACGCTTCATTCTCTCACTATGCTCATGAAGATGCACTCGTAT
TCATTCTACTGTGGGCATCTCTCAGAATGCTATAAGAGGCTCCGAACGCT
TGACGAAAATAATACAAAGGTGGAACCGACTGAAGATGCAGACCTCCGCG
AAGCATTAGCCTTTGAGGTCACTAGTCCTTCTGGAAGAGTGACTTATCCC
AAGAACCTGACCTTGTACAATTTCGTCGACTACCTCTTCTGTCCAACTTT
ATGCTATGAATTGAGCTACCCACGGACTGACCGCATTCGTTGGGGCAAGG
TTGCCGAAAAGGCCGCCGCTGTGTTTGGTTGCATTTTTCTGCTTACTGTG
ACGAGCGAGGAGTTTATTTTGCCGATTCTGGCTGA

Sequences in the Contig:

SY0AAA6YC15FM1