Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA6YB06FM1
Length(NT) : 583
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: BAF1_ABF1, BAF1 / ABF1 chromatin reorganising factor. ABF1 is a sequence-specific DNA binding protein involved in transcription activation, gene silencing and initiation of DNA replication. ABF1 is known to remodel chromatin, and it is proposed that it mediates its effects on transcription and gene expression by modifying local chromatin architecture. These functions require a conserved stretch of 20 amino acids in the C-terminal region of ABF1. The N-terminal two thirds of the protein are necessary for DNA binding, and the N-terminus (amino acids 9 to 91 in S. cerevisiae) is thought to contain a novel zinc-finger motif which may stabilise the protein structure..
Pfam Number: pfam04684 Score: 132 E_value: 6e-09

Sequence:
>SY0AAA6YB06FM1
TTGGCACTTTTTATTTTATTTCGTTTATTTATTTACCTTTTTATTATCAT
TCTGTACCGGCACCGGTATTTCTATTTATTTACTCGAGTAGTTTATATTT
TTATTTTTATTTTTTTTGTTTCTCTCGAGCTTTTGCGCATCCACGTACTG
CAACCCTCCCCATACGAGTAAGAGTACTCGTACTCACCCCCCCTCTCCTG
GATTTGACCCCTCCACATCTCTTGCTCCCAACCACACCCCCTCCGATCAC
AACTGTTGCAATTCCCGAGCCCTTTCTTGACCTCGCAGAAGTGAAGAGAG
ACACACCGAGCATCACCACGCCGAGCCCTCTCACTTTTCTTCTCACGAGC
ACGAGGGGGAAGGTCACCATCATCATCGCGAGGAACAGTTCCAGATTGAG
CGTCAACAGCACCAGCACCAGCACCAGCACCAACAGCACCAGCACCAGCA
CAAACAGCACCTTCAAGGGCATCACGTACATTTGGCGCACGAGGACGAAG
AAGACGAACACGTAGTTACTGAAACCATCCGCGAGACCCATCATCACGAA
TTAGTTCCCCACCGTCCGCATACCCATATCGAA

Sequences in the Contig:

SY0AAA6YB06FM1