Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA6YA23FM1
Length(NT) : 560
Best Gene Model Blast : Link to GSTUMT00006380001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: AAA family ATPase Rix7 (predicted)
Accession: ref|NP_595792.1| Score: 663 E_value: 2e-76
KEGG Definition: hypothetical protein
Accession: spo:SPBC16E9.10c Score: 663 E_value: 9e-77
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0733 Score: 752 E_value: 8e-81
PFAM Definition: AAA, ATPase family associated with various cellular activities (AAA). AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes..
Pfam Number: pfam00004 Score: 463 E_value: 3e-47
Swissprot: O14325|YB7A_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005524 = Molecular function: ATP binding

Sequence:
>SY0AAA6YA23FM1
TTGGGGAGTGCAGCCGCCTCGTGGTGTACTACTCCATGGACCACCCGGTT
GCGGTAAAACTATGCTAGCATGCTGTTGCCGGAGAGATTGGGTTACCATT
TATTGCTATTTCTGCACCCTCAATTGTGTCAGGAATGTCTGGAGAATCGG
AAAAGAAGTTACGGGAACTTTTCGAGGAAGCTCGGGAGAAAGCCCCTTGC
TTAATATTTATGGATGAAATAGATGCTATAACACCAAAGAGGGAGAGCGC
CCAGAGAGAAATGGAGAGAAGAATTGTTGCCCAGATGTTGACCTGCATGG
ACGATCTTACATTGGAGAAGACTAGCGGGAAACCTGTCATGATTATTGGT
GCAACAAATCGACCTGACAGCCTGGATCCGGCGCTGAGAAGAGCGGGAAG
ATTTGATAGGGAAATTTGCCTTAACGTGCCAGATGAGGTTGGAAGAGAGA
AGATACTGAGGGTATTGTGTCAAAAGTTGAGGTTATCAGGAGATTTTGAC
TTCAAAAGATTGGCCAAAACAACCCCCGGGTTTGTCGGAGCTGACCTAAA
TGCTTTGACA

Sequences in the Contig:

SY0AAA6YA23FM1