Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA6YA21FM1
Length(NT) : 285
Best Gene Model Blast : Link to GSTUMT00000284001 E-value : 1e-159
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001544204.1| Score: 375 E_value: 8e-35
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA6YA21FM1
TTGGCGAGCATGTGGAGATTGTCTTGGATTACGTTTATTTTCCTGCCATT
GACATTCATTGTTGGGTTCTTTGGTATGAGCGTTGATACGTTTGCGGACA
ACCCCTCAATAAAGTGGTACTTTATTGTTACCGTGCCATTTATGGCGGCA
GTCCTTGTATCCTGGTATTTGCTTAAGCATTGGCTAACCCGCCATCGCCA
ATCGCCACACGAACGCGGTGTCTACGAAGCCCTATATGCGGATCTCCACA
GCCGCCGACCAGAGCTTTGGTCCCGCGCAGGCCCT

Sequences in the Contig:

SY0AAA6YA21FM1