Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA6YA10FM1
Length(NT) : 268
Best Gene Model Blast : Link to GSTUMT00005616001 E-value : 1e-149
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU02020
Accession: ref|XP_964885.1| Score: 196 E_value: 5e-14
KEGG Definition: hypothetical protein
Accession: ncr:NCU02020.1 Score: 196 E_value: 2e-14
KOG Definition:
Classification: [Inorganic ion transport and metabolism, Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0039 Score: 118 E_value: 8e-08
PFAM Definition: Ferric_reduct, Ferric reductase like transmembrane component. This family includes a common region in the transmembrane proteins mammalian cytochrome B-245 heavy chain (gp91-phox), ferric reductase transmembrane component in yeast and respiratory burst oxidase from mouse-ear cress. This may be a family of flavocytochromes capable of moving electrons across the plasma membrane. The Frp1 protein from S. pombe is a ferric reductase component and is required for cell surface ferric reductase activity, mutants in frp1 are deficient in ferric iron uptake. Cytochrome B-245 heavy chain is a FAD-dependent dehydrogenase it is also has electron transferase activity which reduces molecular oxygen to superoxide anion, a precursor in the production of microbicidal oxidants. Mutations in the sequence of cytochrome B-245 heavy chain (gp91-phox) lead to the X-linked chronic granulomatous disease. The bacteriocidal ability of phagocytic cells is reduced and is characterised by the absence of a functional plasma membrane associated NADPH oxidase. The chronic granulomatous disease gene codes for the beta chain of cytochrome B-245 and cytochrome B-245 is missing from patients with the disease..
Pfam Number: pfam01794 Score: 167 E_value: 2e-13
Swissprot: Q12333|FRE7_YEAST
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane
GO:0000293 = Molecular function: ferric-chelate reductase activity
GO:0015677 = Biological process: copper ion import
GO:0006826 = Biological process: iron ion transport

Sequence:
>SY0AAA6YA10FM1
TTGGGTGGTTTCTTCAGTCTGGTCCACTCGGCACCGTACATTATTGAGCC
GTTGAAGAATGGCGGATGGAGCAAGTTGGCCGAGGTTTTCAATGGCCATG
TGACATATTGGAATGGAGTCGGAGCACTTGTATGCATGTTTTGGTTGACT
TTTGGTTCTCTTAATTTTATAAGGGCGTGGTGTTATGAGGTTTTCGTTCA
TTTGCATATTATTCTGGGAGTGGGATACGTAGGGTTGATGTTCTGGCATT
GCGCTAACGTGTTGACTT

Sequences in the Contig:

SY0AAA6YA10FM1