Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YP01FM1
Length(NT) : 646
Best Gene Model Blast : Link to GSTUMT00010668001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: related to ATP dependent RNA helicase
Accession: emb|CAE76494.1| Score: 331 E_value: 2e-29
KEGG Definition: hypothetical protein
Accession: ncr:NCU02685.1 Score: 331 E_value: 1e-29
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q9UT24|BRR2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005681 = Cellular component: spliceosome
GO:0000393 = Biological process: spliceosomal conformational changes to generate catalytic conformation

Sequence:
>SY0AAA63YP01FM1
TTGGCAAATCCCTTCCACAACAAACCAATCGCGGTCCCAAACTCCTAGTG
CTTTTCTACGGCTTCAATAAATCCTAATATCTGTGCTAACTCGCTTAAAC
TTTCTCCTGTTCTCTCTCCAGAGCCTTACTCTCCAAGAGCTCACTTCACC
GCTCTTAAGACTTCCGGAGGCCTTGCGGTTACCCCATCGCAATCATGGCG
GACCAATCTCAGTACAAGTATGCGAACATGTCTAACCTAGTTCTCCAGGT
AGATAAGCGGTTTACCCACCGGCGCACAGACGAGGCTACCGGAGACCCAG
AATCGTTGGCTGGGAAGGTCGACATTAAGCAGATGGGAGATCGTGCGTTA
CGTGACAATGCGCCGAAGGAGAAGCATATCAAAAAGAAGAAGCAACTGAA
AGAAAAAGACATCGATGGGTTAGAAGATGGTAAGGAGGAGAAGCGGAAGC
GGAAGCGAGATGCTGCTACCTCTCATGGAGGGAGTATTCTTTCAGCTACA
GATGATGTCCTTGGTCTTGTATACCATCCACGCACTGCTGAAACGAGAGA
GGCTTACTCGCTCATTCTCACTCTGGTTTCTACGGTTCTCGGCGATGTTT
CTCAATCGGTGGTTCGTTCGGCTGCCGATGCGATATTAGAAATCCT

Sequences in the Contig:

SY0AAA63YP01FM1