Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YO03FM1
Length(NT) : 614
Best Gene Model Blast : Link to GSTUMT00007000001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: protein kinase, putative
Accession: ref|XP_001258041.1| Score: 359 E_value: 1e-32
KEGG Definition: protein kinase, putative [EC:2.7.11.1]; K08793 serine/threonine kinase 32
Accession: afm:AFUA_6G09240 Score: 359 E_value: 6e-33
KOG Definition:
Classification: [General function prediction only, Signal transduction mechanisms].
Kog Number: KOG0598 Score: 159 E_value: 5e-12
PFAM Definition: No Hit Found
Swissprot: Q5PU49|KPCD_CANFA
Gene Ontology:
GO:0004697 = Molecular function: protein kinase C activity

Sequence:
>SY0AAA63YO03FM1
TGTACCAAAAAAGTTGGCCGTCACAAAACCACCAGTCACCAGAGATTGTA
TGGACGCAATCCGAAGCCTACTGCAGCCGGATGTGACTAAACGGATTGGG
GCAACTGGCTTCAACACTTTCACAAGCCATCCTTTCTTTGCAGATATCGA
TTTCGACGCATTAGAGAGGAAGGAGTATGATCCTGTGTTCAAGCCTTCCA
CTGAGAAGACCAATTTTGACGCTACATATGACCTTGAGGAACTGCTACTG
GAAGAGGCGCCATTAGAGGCTCGAGCTAGAAGACAGAGACCTCGAGAGAG
GTTAAAGGATGATGCTACGGCTCAGGAGATCAGGCAAGAAGAATTGCACA
GAATGATAGAAACACTCTTTGAGCCATTCGATTATACTACGGCTGGATTT
GACAGCCCGACTAAGGGTGGTAGACATCCTGGGACGGTGGATCCTGCTTC
TAAATCTGCCGGTGAACCTCTTGACTGGTCCCAAAAGTCGTTAGTGGGTT
CTCCTGCGTCTGGATCTCCCCCTATTCCATCATGCACGGATCTTCCTAAA
GTGTGTCCACCACCTCGTTCGATGCCACCTACGGTATCCTCGACCGATCG
CTCTAATATGAAGG

Sequences in the Contig:

SY0AAA63YO03FM1