Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YN14FM1
Length(NT) : 607
Best Gene Model Blast : Link to GSTUMT00008074001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: vacuolar H+/Ca2+ exchanger
Accession: ref|XP_001260282.1| Score: 311 E_value: 5e-33
KEGG Definition: vacuolar H+/Ca2+ exchanger; K07300 Ca2+:H+ antiporter
Accession: afm:AFUA_2G07630 Score: 305 E_value: 1e-32
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG1397 Score: 293 E_value: 1e-27
PFAM Definition: Na_Ca_ex, Sodium/calcium exchanger protein. This is a family of sodium/calcium exchanger integral membrane proteins. This family covers the integral membrane regions of the proteins. Sodium/calcium exchangers regulate intracellular Ca2+ concentrations in many cells; cardiac myocytes, epithelial cells, neurons retinal rod photoreceptors and smooth muscle cells. Ca2+ is moved into or out of the cytosol depending on Na+ concentration. In humans and rats there are 3 isoforms; NCX1 NCX2 and NCX3..
Pfam Number: pfam01699 Score: 120 E_value: 2e-07
Swissprot: Q99385|VCX1_YEAST
Gene Ontology:
GO:0000324 = Cellular component: vacuole, cell cycle-correlated morphology
GO:0015085 = Molecular function: calcium ion transmembrane transporter activity
GO:0006816 = Biological process: calcium ion transport
GO:0006874 = Biological process: cellular calcium ion homeostasis

Sequence:
>SY0AAA63YN14FM1
TTGGCTAGCCTTCTCGAGCGCCCAATTTTCTCGAAGGCTCCCGAGAGTGC
TTGGTGTGATAATCCAACTTACTTTTGCTTCTTCCGTCGAGGTCATTCTA
TGCCTCGTGCTGCTATTCAAGTCATCCAAGCGGCTCTCCTGGGCAGTATG
TTGGCCAATCTCCTCCTCTGTACGGGCCTCTGCTTCATCGTCGGCGGGAT
CCGCACGAAAGCGCAAGAGTTCAGCGAAACCGTGGTAGAAACTGGCGGCG
GATTGCTCCTAGTCAGCGTGGCATCCTTGATGCTCCCATGCGCCTTTTTT
GAGTCAGTATCCGCAATGGGCCGCCTCCCCCAGGACGAGCTCGATCACAA
GGTCCTCCACATATCTCGCTTCTCGGCGGTACTACTTCTGATAGCCTACG
TCACGTATCTCTTCTTCCAGCTCGCCACTCATCACTCCGAGTTTGACCAG
GCACTCTACGAGAGCGAGCAGAGGAACAAAGACCGGGCAGACAATATCCG
CCGGGAAAACCTAACAATTGGCGAGGCGGCCTTTTTGACATTCATGAGTT
TGGCATTCGTCACGCTGCACGCCGTGTTCCTAGTTGAACAGATTCATTGG
ATTGTCT

Sequences in the Contig:

SY0AAA63YN14FM1