Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YN13FM1
Length(NT) : 513
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 355 E_value: 2e-32
KEGG Definition: hypothetical protein
Accession: ani:AN8767.2 Score: 344 E_value: 2e-31
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 227 E_value: 5e-20
PFAM Definition: No Hit Found
Swissprot: Q9ULJ7|ANR50_HUMAN

Sequence:
>SY0AAA63YN13FM1
TTGGCAGGAGTGGTTAAGATACTACTGGAACGGGAGAACGTCAACCCTAA
TTGCGCGGATGTGAACGATCGAACACCACTTGGGTGTGCGGCTACCGAAG
GACACGAAGGAGTAGTTAAGCTACTGTTGGATCAGGAAGGTGTCGACCCC
AATCATCCAGATGTGAATGATCGAGCACCTCTCGGGTGTGCTGCCGCTGA
GGGACATGAGGGAGTGGTCAAGCTACTACTAGGCCGGGAAAATGTCAACC
CCAATCGCCCAGATGTAGATGATCGAACACCACTCGGGTGTGCTGCCATG
AAGGGACATGAAGGAGTGGTTAAGCTACTGCTAGAACGGGAAGGTGTCGA
CCCCAATCATCCGGATGTGGATGACCGAACACCGCTAGGATGTGCTGCTG
TAAAGGGATATGAGAAGGTAGTTAAGCTGCTGCTGAGGCGGGAAAATGTT
GACCCTAACCACCCGGATGTGGATCATCGGACACCACTTGGGTGTGCTGC
TGTGAAGGGATAT

Sequences in the Contig:

SY0AAA63YN13FM1