Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YL21FM1
Length(NT) : 670
Best Gene Model Blast : Link to GSTUMT00000727001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_00855
Accession: ref|XP_001791526.1| Score: 460 E_value: 3e-44
KEGG Definition: hypothetical protein [EC:2.3.1.181]; K03801 lipoyl(octanoyl) transferase
Accession: spo:SPAC4F10.05c Score: 406 E_value: 2e-38
KOG Definition:
Classification: [Energy production and conversion, Coenzyme transport and metabolism].
Kog Number: KOG0325 Score: 421 E_value: 2e-42
PFAM Definition: BPL_LipA_LipB, Biotin/lipoate A/B protein ligase family. This family includes biotin protein ligase, lipoate-protein ligase A and B. Biotin is covalently attached at the active site of certain enzymes that transfer carbon dioxide from bicarbonate to organic acids to form cellular metabolites. Biotin protein ligase (BPL) is the enzyme responsible for attaching biotin to a specific lysine at the active site of biotin enzymes. Each organism probably has only one BPL. Biotin attachment is a two step reaction that results in the formation of an amide linkage between the carboxyl group of biotin and the epsilon-amino group of the modified lysine. Lipoate-protein ligase A (LPLA) catalyses the formation of an amide linkage between lipoic acid and a specific lysine residue in lipoate dependent enzymes..
Pfam Number: pfam03099 Score: 112 E_value: 2e-06
Swissprot: O36017|LIPB_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>SY0AAA63YL21FM1
TTGGCCCGACTTCTCCATATCCATCTCGGAAAAACTACTTATGCCTCGGC
TGCGGCCCTCCAAAAATCACTCCTATCCGCCCACCTCTCACACAAATCTC
GAACAACCCTAATCCCCATCTCGCCATTGCCAACCCTCATTACCACCCAG
CCTCCGGAACCCACGGTGATAACCTCCGAATTCCACCCCCCCGTATACAC
CCTCGGTCGCCGGGAGTCACAATCGCCCTTAACCCCCGAGCGGGAATCCC
ACCTCCGCGTTAGGGGCGCGGAACTGCAATACACTCCCCGCGGCGGGCTG
ACTACATTCCACGGCCCGGGCCAGCTTACGGCCTACGTCATTGCCGATCT
TCGGCATCACGGCTTGAGGCCTAGGTGTTATATTCGAACTCTTGAACGGG
CGCTTGTGGCGACGTGTGCTCAGTGGGGTATTCGCGCCTTCACCACGGAG
GATACTGGTGCTTGGACTTCGGAGAACAGGAAGATTGGCGCGGTGGGCGT
GCACATGCGGAGGTTTGTGAGTAGTTTTGGGGTTGGGTTGAATGTTTCTA
CCGATCTATGGTGGTTTGATAGGATTGTAGCTTGTGGGCTAGAAGGGAAG
GGGACTACTAGTTTCGTGAGGGAGGGTGTGGTAGGGGTTGGTGTAGAGGA
GGTTGGGGATAGGTTTGTTA

Sequences in the Contig:

SY0AAA63YL21FM1