Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YL20FM1
Length(NT) : 581
Best Gene Model Blast : Link to GSTUMT00007846001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_04188
Accession: ref|XP_001794612.1| Score: 360 E_value: 7e-33
KEGG Definition: 2-polyprenyl-6-methoxyphenol hydroxylase and related FAD-dependent oxidoreductases
Accession: aor:AO090701000891 Score: 326 E_value: 3e-29
KOG Definition:
Classification: [Energy production and conversion, General function prediction only].
Kog Number: KOG2614 Score: 164 E_value: 1e-12
PFAM Definition: HI0933_like, HI0933-like protein..
Pfam Number: pfam03486 Score: 123 E_value: 7e-08

Sequence:
>SY0AAA63YL20FM1
TTGGGCAACTCTTGCCCCCGGGAGAGGCAAAGGAAGTGGGAAGAGGTGGC
CTTTGAATAATTCTTCTTTCAATTCTATGAATTAGAATTCGTGATGGGGA
GAGCTTGTATTCGACTTAATGTCATCGTCGTCGGAGCCGGCCTAGGCGGG
CTGGGAGCGGCGATAGCAATCTCCCTCGCGGGCCACAGAGTAACGGTTCT
AGAGGCTTCTCCTACGGCCGGAGAAATAGGAGCAGGAATCCAAATCCATC
CGAACGCTTCAAAGATCCTAACAGCATGGGGCATGCGCGAAGCCCTCCTC
CAATATGCCACGCTGCCAAAGCAGGTGAACATGATCGGCTGGAAGGGCAA
CCACATAAGCCACATGAATTTTGCCGAGCACGCAAAAAGGTACAACTCCC
CCTTCTGGGACTTTCACCGCGCTTCCCTACACAAGTGCTTGCTGGACCGG
GCCGTTGAGCTCGGCAGTAAAGTCCTGATGAACTCGAGGGTGGACCATGT
GGAGTTCGGGCAGTTGGGCGGCGCGTGCACGGTTTTGCTGCACAATGGGA
GGAGGTTGAGTGCGGATTTGGTTGTGGGTGC

Sequences in the Contig:

SY0AAA63YL20FM1