Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YK20FM1
Length(NT) : 571
Best Gene Model Blast : Link to GSTUMT00010688001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein ATEG_01357
Accession: ref|XP_001208722.1| Score: 626 E_value: 1e-63
KEGG Definition: hypothetical protein
Accession: ang:An02g05450 Score: 593 E_value: 3e-60
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2015 Score: 541 E_value: 2e-56
PFAM Definition: ThiF, ThiF family. This family contains a repeated domain in ubiquitin activating enzyme E1 and members of the bacterial ThiF/MoeB/HesA family..
Pfam Number: pfam00899 Score: 318 E_value: 2e-30
Swissprot: Q99MI7|UBA3_RAT

Sequence:
>SY0AAA63YK20FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGGCTCCACACAAACCGAG
CAGCTGTCAGAACTTGCAAAAATGACAATAGCTGACTCCCCAAAATGGAA
GTACCTGGATAGGATCCTCAGTCGGAAGGGACCCTTCACCGATGAGGACT
ATGACACCGAAATGCAAAAGACATTCCTCGATGATTTTAAAGTCTTAGTC
ATCGGAGCGGGAGGTCTAGGCTGCGAAATCCTGAAAAATCTCGCCCTCTC
TGGCTTTAAAGATATTCATGTAATAGACATGGACACGATCGATGTCTCGA
ACCTTAACCGACAATTTCTCTTTCGAGCCTCCGATGTCGGAAAACCGAAA
GCTACGGTGGCAGCCTCGTTCGTAATGTCCCGTGTCAAGGACGTCACCAT
AACCCCATACTACGGTGCAATTCAGGATAAGGATCAGGAATACTACATGC
AGTTTAAGCTCGTTATCTGCGGTCTCGACAGTGTTGAAGCAAGGAGATGG
ATTAATGCTACCTTGGTCGATATGGTGGATATCGATAACCCGGAAAGTTT
GAAGCCACTAATTGATGGTGG

Sequences in the Contig:

SY0AAA63YK20FM1