Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YI12FM1
Length(NT) : 588
Best Gene Model Blast : Link to GSTUMT00002894001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_06451
Accession: ref|XP_001796822.1| Score: 374 E_value: 2e-34
KEGG Definition: hypothetical protein
Accession: ncr:NCU09159.1 Score: 332 E_value: 7e-30
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1804 Score: 168 E_value: 4e-13
PFAM Definition: No Hit Found
Swissprot: Q9HCE1|MOV10_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAA63YI12FM1
TTGGGGCAGATCGTAAATGTTCACTGGACAGCCCTGCTACTGGATGAAGC
GGCGCAAGGTATCGAACCGGAAGTCGCAGTTGCAGTTTCTGTTGTAGTAC
CCCCGGAGGAAGCTAGCGTTGATAGGCCAATTTTTGTCATGGCGGGTGAT
CAGAGGCAGTTGGGACCAAGAACTGTCAGCAGGGTACCACAGCTTGATAT
GAGTCTGTTTGAGAGGCTTTTTTTACGAGAGCTTTACAGCCAGCATCCGT
TGGCTAGGCAAAGCTTTACGCATGCTTACAAGCAGAGCCCTCGGGTATGG
AGTGCGGAGAGAATTCTAGAGAGGAAGAAGGCATTACTGCCGTATCTCCG
CCCGCCGTTTACGAATTTAATTCGGAATTACCGCTCTCATCCAGCAATTC
TGGCTGTACCAAGCGCTCTCTTCTACAATGACACTCTGGTCCCTGAGGCG
TCAAATACGAATTATCTAGAGGGGTGGTCTGGATGGAAGGGTAGGAGAGG
GATCCCCGTGAAATTCTGTCTTAATGGAGGGATGGATGAATGGCATGAAG
AGGGGGTCTCGTTTTACAACCTCCGCGAGATAAAAATT

Sequences in the Contig:

SY0AAA63YI12FM1