Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YH04FM1
Length(NT) : 646
Best Gene Model Blast : Link to GSTUMT00001750001 E-value : 1e-124
Numbers of ESTs : 1

Blast Results:

Nr Definition: Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gb|AAB38246.1| glycerol-3-phosphate dehydrogenase
Accession: sp|Q00301|G3P_BOLED Score: 350 E_value: 1e-31
KEGG Definition: GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE (GAPDH) (CLOCK-CONTROLLED PROTEIN 7)
Accession: ncr:NCU01528.1 Score: 341 E_value: 8e-31
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG0657 Score: 356 E_value: 8e-35
PFAM Definition: Gp_dh_N, Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain. GAPDH is a tetrameric NAD-binding enzyme involved in glycolysis and glyconeogenesis. N-terminal domain is a Rossmann NAD(P) binding fold..
Pfam Number: pfam00044 Score: 391 E_value: 8e-39
Swissprot: Q00301|G3P_BOLED

Sequence:
>SY0AAA63YH04FM1
TTGGTATTTTCATCAATACTCCGCTATTTCCCCCCAAACATTTTACTCGC
TTTACACTCCAGTAAGTACCTCTTGTTTTGCCCTTCTCGAAGCACCGAGT
CATCCAAATCCTCACTCCGATACTTCCTTCCATTTCCCTGTGATAATTGT
TTGCGATAATCCGAATCCCCTTCTGCCTACTACCTCTTCCTATAGGCTCC
GTTCACTTGGTATCGGGAAATTAATAAAATATATAGGGTTCTCAATTCAA
AATGGCCGTCCCCATTGGTATTAAATAATTCTTTCACCGGATGAATATTT
CTGGCTTACTTTTGTGGTAAATATCGTAGGTCCTCCGTAATGCCGCCGAA
CGCGACGACGTCAGGGTTGTAGCTGTTAACGATCCCTTCATCGATCCTAA
ATATGCGGTCTACATGTTCAAGTACGATTCCGCTCATGGAAATTTTAAGG
GAGAGGTTAGCACCAACGATGCTGGCGACTTGGTTGTCAATGGAAAGACT
ATCAGGATGTACTCCGAGAGGGACCCTGCCAATATCCCATGGGGAGCTGC
TGGTGCTGAATACGTCGTTGAGTCTACTGGTGTTTTTACTACCACCGAAA
AGGCGAGCGCTCACTTGAAGGGCGGTGCCAGGAAGGTTATCATTTC

Sequences in the Contig:

SY0AAA63YH04FM1