Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YG13FM1
Length(NT) : 606
Best Gene Model Blast : Link to GSTUMT00011683001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_07709
Accession: ref|XP_001591084.1| Score: 341 E_value: 1e-30
KEGG Definition: hypothetical protein
Accession: fgr:FG05579.1 Score: 332 E_value: 7e-30
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2913 Score: 273 E_value: 3e-25
PFAM Definition: PQ-loop, PQ loop repeat. Members of this family are all membrane bound proteins possessing a pair of repeats each spanning two transmembrane helices connected by a loop. The PQ motif found on loop 2 is critical for the localisation of cystinosin to lysosomes. However, the PQ motif appears not to be a general lysosome-targeting motif. It is thought likely to possess a more general function. Most probably this involves a glutamine residue..
Pfam Number: pfam04193 Score: 179 E_value: 3e-14
Swissprot: P38279|YBZ7_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>SY0AAA63YG13FM1
TTGGTAGACTGGTTATTTCTTGCTGCTAGTCGATTTCCCTCCTCCAATTG
GGCCATCTACTAACTCAGCTCACTCTTACACTAGATTTCTTGAATTTTCC
AATATCTAGAGATTAGACTCGGCACTTTCTATAACTTAGAAAGACCGAGT
CGATATATACCACCGTTAAATATGTTTCCTCCTGCACAGCAGCTGGATAT
TGACGCAAGGGCCATTAGCGGAATTGCAGGGTCGATCTCGATCGCTTGCT
GGATAGTAGTTTTCTCCCCGCAGATTATCGCCAATTTCCAGCGAGGGTCA
GCCAATGGACTTTCTTTGGCCTTTCTGATTGTTTGGCTGGCTGGGGACGT
TTTCAATGTTCTTGGGGCTGTTCTACAGGGCGTATTACCTACAATGCTGT
AGGTGATGTTGGCCGTTTATTATACCCTCGCAGACGTAGTTCTCCTATTC
CAGTGTCTCTACTACAGCTGCATCAACTCTCGCAATGCAGCTCCAGAAGC
CGAGAGTTTGCTCCCCGTCTCGAATGAATCAGCCGCTACTGTTGATGGAT
CGCATCTCTCTCCTGCAACACCGCTTCTGGATCCTGCGAAAGAGCCTATA
CACACC

Sequences in the Contig:

SY0AAA63YG13FM1