Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YF21FM1
Length(NT) : 633
Best Gene Model Blast : Link to GSTUMT00005025001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_07478
Accession: ref|XP_001225134.1| Score: 441 E_value: 4e-42
KEGG Definition: hypothetical protein; K03320 ammonium transporter, Amt family
Accession: mgr:MGG_05526 Score: 413 E_value: 3e-39
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0682 Score: 390 E_value: 9e-39
PFAM Definition: Ammonium_transp, Ammonium Transporter Family..
Pfam Number: pfam00909 Score: 315 E_value: 4e-30
Swissprot: Q9US00|AMT2_SCHPO
Gene Ontology:
GO:0005887 = Cellular component: integral to plasma membrane
GO:0008519 = Molecular function: ammonium transmembrane transporter activity
GO:0015200 = Molecular function: methylammonium transmembrane transporter activity
GO:0015696 = Biological process: ammonium transport
GO:0015843 = Biological process: methylammonium transport
GO:0007584 = Biological process: response to nutrient

Sequence:
>SY0AAA63YF21FM1
TTGGGGGACAACTTTGTACAAAAAAGTTGGGGGACAACTTTGTACAAAAA
AGTTGGGGGGACAACTTTGTACAAAAAAGTTGGGAAGCGGAATTAGCGAA
AGCAGCCGCTTTCCCTAGAGATGATGAAAACCCTGACAACGTTTTCCACG
TCGTGCTTGGGACGACCCTACTCTGGGTGGGGTGGATGGGCTTCAATGGA
GGCACGACATTAGGAGCGAACTTAAGAACAGTCTCAGCACTTGTTTCGAC
GAACCTTGCTGCATGCTCAGGCGGACTAACATGGTGCTTTTTGGAATTCT
TTTTCTCCAAATACAACCCCGAGCGTGATCCCACAGGTTGCCCGAAACGG
AAACCTGTTCCAAGAAGACTCTCGATTCTTGCCTTTTGTAATGGTGTTAT
CTCTGGTCTAATAACAATTACACCAGCTGCGGGTTACGTGCCATTGCATA
GTGCTATATGTTTTGGGGTTGTGGGTGCAGTTTGCTCGAACTTCTCTGAA
GTGTTAAGCAAACCTATAGGTGACATAAACGATATATTCTCTATCCATGG
GGTCTCGGGCTTCGTTGGGATGCTTCTAACTGGCGTGTTCGCACGGGACG
ATATTGCCCGTCTTGATGGATACACAAATATTC

Sequences in the Contig:

SY0AAA63YF21FM1