Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YF11FM1
Length(NT) : 584
Best Gene Model Blast : Link to GSTUMT00008148001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1144 Score: 125 E_value: 4e-08
PFAM Definition: TolA, TolA protein. This family consists of several bacterial TolA proteins as well as two eukaryotic proteins of unknown function. Tol proteins are involved in the translocation of group A colicins. Colicins are bacterial protein toxins, which are active against Escherichia coli and other related species (See pfam01024). TolA is anchored to the cytoplasmic membrane by a single membrane spanning segment near the N-terminus, leaving most of the protein exposed to the periplasm..
Pfam Number: pfam06519 Score: 125 E_value: 4e-08

Sequence:
>SY0AAA63YF11FM1
TTGGGACACCGGAAAAGGTCGTCCCATCCTCTCCGATGCTCCGGGCGCAG
ATGGCATCGAGAGAATCGGCACACCAAGAGGCGGCCTAGAACGTAGCAAA
TCCGAGTTAGCCCGCAGCAAAGAACTAGCGAAAGCAAAGATCGCGAAAGC
CCAGGAAGTAGCACGAGCAAAAGAAGCCGCAGCAAAAGCCAAAGAAGCGA
TAAGAATCTACGAATTGACGAAAGCAAAAGAACTTGCAAAGGCCAAAGCC
GAACTTGAAAAATTCAGGCAAGCAGTCACCCCACAACCCGAGAACCCAGA
CAGCGAGAAGAGGCCTGCTTCTCCTGAAGCCGGTAGCGAGAGCGATGAAC
CTCCTAAAGAGCCCCCCCTCAATAAAGAAAAAAAGCCAGTAAGGGCTATT
AAAGAAGCCCCGCCAAGACCCGAATCATCGAAAAGAAAGCCGAAACGCAC
CCACTCCAAGACAGAAACCAGTGAAGAGCGTGCAGCAACGCGCGAGAAAC
GCGCAGAGAAGCGGCGCAAGCGCCTCGCGGAAAAGGACGAAGAGCCCGAA
ATTAAGCTGGACACCAACACAGAGGAGATCAATA

Sequences in the Contig:

SY0AAA63YF11FM1