Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YE17FM1
Length(NT) : 603
Best Gene Model Blast : Link to GSTUMT00010320001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_01545
Accession: ref|XP_001559986.1| Score: 258 E_value: 5e-21
KEGG Definition: protein kinase domain-containing protein
Accession: afm:AFUA_3G13210 Score: 206 E_value: 3e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA63YE17FM1
TTGGCTCCGAAGAGACACCCTCTCCGTCGTCAACAAACATCTCCGTCGGT
CACTGGTCATCAGCTACCCCTGCTCACCCTGCCACATCTGATGTGTTCTC
CTTAGGATGCATATATCTAGATGTCCTATCGTTCAAACAAAAGCGTAAAA
CCACGGCATTCATCTCCCATCGATCTGCCAAGAATCGACGACCTCGGGAG
TCCGGTCCGCCGGACGCTTCGTTCCATTCTAATCTCGGACAGGTGGACAG
CTGGATCGGCGGGCTTCTCAAAGAGACGAAGAAGAAGCCTGACGAAGCAC
TTGTCGAAGCGTTAGGCATTACCAGGAGAATGTTATTACGAAACCCAGAA
GCCCGTCCGGGAGGGCGAAGAGTTGCGGATGAATTCTATACCGTTGTTAG
CGGTGCATGCGAAGGTACCGAGGCGCCGTGTTGTGGAGTGCATAATATTG
TTGGTGGTAATGCCGAAGGGGAGGTTTTTGGCGGATGGGGGATTGAGAGT
TTAATGCTCAAAACGCAGACCTCGAGGGGCAGCGCGGGGAGTGAAGGGCT
ATTGTCCAAGAGGAGTACTGTGGGGACTAGAGCGAGTGGGAGTTCGGGAT
CTG

Sequences in the Contig:

SY0AAA63YE17FM1