Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YE07FM1
Length(NT) : 427
Best Gene Model Blast : Link to GSTUMT00005319001 E-value : 1e-145
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_00188
Accession: ref|XP_001598102.1| Score: 468 E_value: 1e-45
KEGG Definition: hypothetical protein
Accession: ang:An17g02340 Score: 463 E_value: 2e-45
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2509 Score: 435 E_value: 3e-44
PFAM Definition: No Hit Found
Swissprot: O14018|SYSC_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAA63YE07FM1
TTGGAAAAGTATGATCTCGAGGCTTGGTTCCCTTTCCAGGGCGAGTACAA
GGAACTCGTTAGTTGCTCTAATTGCACAGATTATCAGTCACGTAACCTGG
AGATAAGATACGGGACAAAGGCTCAGACTGACACTGTCAAGAAATACGTT
CACTGTCTTAACTCCACCCTCTGTGCGACTGAGCGTTCTCTTTGTTGCAT
TTTGGAGAACTACCAGACCCCTGAGGGTATCAACGTCCCCGAAGCCCTCA
GGAAGTACATTCCTGGGGCTCCAGTGTTTATACCATTCAGCAAAGAGTTG
GCTACGAATAGCACCTCGATGAGGAGGGGGAAGCCTAAGGCGTAGATAGT
TAGATAGTGCATAATTAGTAGCAAAAACTAGGGTGCCCACTACACAAATA
GCTTCAATACTAGACTTGAGTTGGGGG

Sequences in the Contig:

SY0AAA63YE07FM1