Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YD02FM1
Length(NT) : 619
Best Gene Model Blast : Link to GSTUMT00002432001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An01g04300
Accession: ref|XP_001388857.1| Score: 539 E_value: 2e-53
KEGG Definition: hypothetical protein
Accession: ang:An01g04300 Score: 539 E_value: 8e-54
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2180 Score: 283 E_value: 2e-26
PFAM Definition: Vps53_N, Vps53-like, N-terminal. Vps53 complexes with Vps52 and Vps54 to form a multi- subunit complex involved in regulating membrane trafficking events..
Pfam Number: pfam04100 Score: 248 E_value: 3e-22
Swissprot: Q8CCB4|VPS53_MOUSE
Gene Ontology:
GO:0010008 = Cellular component: endosome membrane

Sequence:
>SY0AAA63YD02FM1
TTGGCTTACCCGCCCTCTCCCTACTGTGCATCGTACTTCTCGCCTTTGCT
CCCTACGACTTTTTGTGAGAATACTGGTGCTATTCCGGGGAAATGTTTGC
GTCGAACGGGGGGTTTCCCACTCACGGAGGTGTGCCGGTGGATCCCTTGG
ATTCCGCTGATTATGACCCAATAATTCATCTCAATACTCTATTCTCACAC
CCTTCTACATTATCTGCTGTGCCTTCAACCTCCCATGCATTGCGCAACCA
CCTCGATTCGCTAGATAATGAAATCACACAGCTGGTTATAACCCAATCTA
CCACAAATGCGGACTCTCTTGCCCGAATCTCCTCCGCGAAGGTAGAACTA
GCTGGCCTCCTGGAGAATGTCGATACTGTTCGCGAGAGGGCTATCAGGAC
TGAAGATGCCATTGCTGCTATGACCGCCGATATCAAGAAGCTAGATTCGA
CGAAACGGAATTTGACACTATCCATGACAGTCCTCAAGAGGCTGCAGATG
TTGACAACGGCTTACGAGCAAATGAAGACTCAGTCCAAAAATCGACAATA
CCGGGAATGTGCCTCTCTCATGTCTGCGGTCCTAGAGCTTATGGCACATT
TCCGTTCATTCCGGTCTAT

Sequences in the Contig:

SY0AAA63YD02FM1