Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YC18FM1
Length(NT) : 567
Best Gene Model Blast : Link to GSTUMT00005951001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG08155.1
Accession: ref|XP_388331.1| Score: 219 E_value: 2e-16
KEGG Definition: hypothetical protein
Accession: fgr:FG08155.1 Score: 219 E_value: 8e-17
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 180 E_value: 2e-14
PFAM Definition: No Hit Found
Swissprot: Q5F478|ANR44_CHICK

Sequence:
>SY0AAA63YC18FM1
TTGGGGTTCGGGAGCTCCCCTCTAATCTCCAAACTGCACCGAATGCATTC
CCGCTTCTTGCTTATGCTTCCTGTTACTGGGGAGCTCATTCTCGGAAGGA
GATCACACCGTCTATAAGGTACCTTGCGCTTGGGATTCTGGAACAATACC
CCCAACATGCAGCTGCAAGCATCTTTTTGTCCAATGGAGGAGCCCCGTGG
CACTGGCGGCACAGCTCTACGGGGTTTAGTGGATTGCATTATGTTGCATA
CTTTGGAATTGATGGGCTTTTGGAGGCAGTGCTGAGCATGGAGCCGGCGA
ATTTGAATCTAACTGATGAGTGGGGCCGCACACCGCTGATTTTAGTTGCG
GGAAAGGGGAACGCTGGAGCGGTAAGGATCCTAATAAGCCGTGCCGATGT
CGACCCAAACTCAGCAGACCGGTATGGCCAAACACCGCTTTCCCGAGCTT
CTGCGACCGGCCACGAAGGGGTCGTAATGGCTCTATTAAGCCGCGCCGAT
ATAAACCCCAACTCACTAGATTGGCGTGGCCAAACACCACTCTTTATAGC
TTCTGCAGATGGCCATG

Sequences in the Contig:

SY0AAA63YC18FM1