Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YC02FM1
Length(NT) : 549
Best Gene Model Blast : Link to GSTUMT00011224001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001269754.1| Score: 197 E_value: 5e-14
KEGG Definition: hypothetical protein
Accession: ang:An01g02850 Score: 188 E_value: 3e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q10141|YAS5_SCHPO
Gene Ontology:
GO:0005730 = Cellular component: nucleolus

Sequence:
>SY0AAA63YC02FM1
TTGGCCAAAAGCTGATCACGAAATTCGCGATAGCTCAAAAAAAGATATTA
TATTTGGGAAGGCAAACGAACAGATTTATTGTCTAACAGAATGGAGTATG
GAGACCGAGGGCAAAATTTACCGGTATATCGTTGTTGGGACAAGCTATAT
CAATGTTACAGCTTCTAGTCTCCTTAAAGGCCGTGTTCTAGTACTGTCAG
TTATTCTAGGCCCGTCCGGCGGTGTTGAAGTCCGTCGACGGTACCAGATC
CAGTGTGACGCACCCGTGTATTCGCTTGCACCGTACAGCAGCAGTTCACT
AGTATACTGCTCAGGTCACAGCATCAATATGCGGACTTTAAACGCGCAGA
CAAAGAAATTTGATGTTGTCGCAGAGAAAAAGCTTAGATCCCCAGCAGTT
CAGATAACTGTTGCAGAACCTTGGATACACTTATCATGTGGCGAAGATTC
AATGCTCGTTCTCAAATTTGAGGATGATAAATTCAACGAACTTTTCAGGT
ATGGCATCTCTGCCGAATATCTGATGGTACGATATTCATAACAGTTTCT

Sequences in the Contig:

SY0AAA63YC02FM1