Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA63YB07FM1
Length(NT) : 496
Best Gene Model Blast : Link to GSTUMT00002265001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 412 E_value: 4e-39
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 370 E_value: 2e-34
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 241 E_value: 1e-21
PFAM Definition: No Hit Found
Swissprot: Q8UVC1|INVS_DANRE
Gene Ontology:
GO:0010171 = Biological process: body morphogenesis
GO:0001822 = Biological process: kidney development

Sequence:
>SY0AAA63YB07FM1
TTGGGGTGCAGTCAAGCTACTTCTTGAGCGCGGGCATGTAAACGCCGATT
TAACAGATAATGATGGACGAGCACCACTATCATATGCAGCGAATTATGGG
AGAGAAGGTGTAGTCAAGCTACTTCTTGAGCACGGGGATGTCAACGCCGA
TTTACCAGATACTGATGGACGAACACCACTATCATATGCCGCGGAGTCTG
AGAGTGAAGGTGTAGTGAAGCTACTTCTCGAGCGTGTGGATGTCGATACC
GATTTAACAGATAAAGCTGGGCGAACACCACTATCATATGCCGCGGAGTC
TGAGAGTGAAGGTGTAGTCAAGCTACTTCTTGAGAGCGGGACTATCAATA
CCGATTTACCAGATAATCGTGGGCGAACACCACTATCATATGTCGCGAAG
TCTTGGAGTAAAGGCGTAGTCAAGCTACTTCTTGAGCGCGGGGATGTCAA
TGCCAATTTAACTGATAAAGCTGGGCGAACACCACTATCATATGCC

Sequences in the Contig:

SY0AAA63YB07FM1