Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA62YM19FM1
Length(NT) : 637
Best Gene Model Blast : Link to GSTUMT00003820001 E-value : 1e-145
Numbers of ESTs : 1

Blast Results:

Nr Definition: putative farnesyl-diphosphate synthetase
Accession: gb|ABD66600.1| Score: 421 E_value: 1e-74
KEGG Definition: hypothetical protein
Accession: yli:YALI0E05753g Score: 269 E_value: 2e-37
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG0711 Score: 293 E_value: 2e-27
PFAM Definition: polyprenyl_synt, Polyprenyl synthetase..
Pfam Number: pfam00348 Score: 171 E_value: 2e-13
Swissprot: P49349|FPPS_KLULA
Gene Ontology:
GO:0004161 = Molecular function: dimethylallyltranstransferase activity
GO:0004337 = Molecular function: geranyltranstransferase activity

Sequence:
>SY0AAA62YM19FM1
TTGGCGAAGACAATCAATTCCCTTTTGCCGGTTGTCATAGTGTTTACTAT
CTCGACGGCCTCTATCCCCCTTTCAACACTTTCCCCTTTGGAATATTTAA
ACTCGATACAAACATGGCTACCACACGTCCACAATTCGAAGAAGTCTTCA
CTAATGTCATTGTCCCTGAATTGGTTGCTGAGGTTAGGAAAACTCAGATT
TCTGAGAATGCCATTCAATGGATCGAGAGGAACTTTCTCCACAATACCCT
TGGTGGAAAGTACAATCGTGGAATGACTGTTCCTGACACTTACCGTCTCC
TCGCTGGCAAAGAGACGCTTAGTCTCGCAGAATACAAACTTAGCGCAATT
CTCGGATGGTGCACTGAACTGGTTGGCTATCCATCCCGTTTCCCGATTGA
CGCTTATATTATAATAACCTCTCTCCAATGTAGCTTCAAGGAATGTTCCT
CGTTGCCGATGACATAATGGATAGTTCCAAGACGCGCCGAGGCTCCCCCT
GCTGGTACCTGATGGAAGGTGTTGGGTCCATTGCTATCAATGACTCGTTC
CTCCTCGAATCCTCGATCTACGTTCTTTTGAAGAAATACTTTAAAGGAAC
CGACTACTACATCGACCTTGTCGAGCTTTTCCATGAT

Sequences in the Contig:

SY0AAA62YM19FM1