Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA62YK14FM1
Length(NT) : 527
Best Gene Model Blast : Link to GSTUMT00008364001 E-value : 1e-173
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_07351
Accession: ref|XP_001225007.1| Score: 274 E_value: 5e-23
KEGG Definition: hypothetical protein
Accession: mgr:MGG_06768 Score: 273 E_value: 4e-23
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA62YK14FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCACCTCCCTGGTCTCTCCAA
AGTTATAAGCCGGATCCAAGTTTGCCGCCGGATCAGCAGATTATACCCAC
TGTCGCCAAGCGTATGCAGCAGGAACAGTGGGAGAGAGACGGCGCATATG
CCAGTGTTTATGACCGCGAGCTCAGACCTCTTAAGGTTCCCTCAGATCCA
AATCTCGATAAGGAGAAGGGGAAGACAGGAGAAACGGATGAACCTGAGTG
GCCATTAAAGAGCCCGGCCCTTCAACCCAAGCTGCCAGTGGGGAAGCCAA
AGTCAGATGCTGGGTACAGGACAGTGCCTACGGTCAACGGAGCATCGGGG
TCAAACACGGTACCCAAAATCCAACAGATGCAACTGCAGCCGAACGACGT
GGAGGGTGGCAGGGACAAGAAAAAGAAGAAAAGCTTGTGCTGTTGCGTCA
TATGCTAAATTTCTTCTCACAGACCTTTTTCCTTTTCCCTAGCTGTGGAT
CTTTGATACAAGAAAATCGACTCAAGA

Sequences in the Contig:

SY0AAA62YK14FM1