Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA62YI19FM1
Length(NT) : 592
Best Gene Model Blast : Link to GSTUMT00003942001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_07137
Accession: ref|XP_001243241.1| Score: 387 E_value: 6e-36
KEGG Definition: phosphorylcholine transferase/cholinephosphate cytidylyltransferase [EC:2.7.7.15]; K00968 choline-phosphate cytidylyltransferase
Accession: aor:AO090005001594 Score: 361 E_value: 3e-33
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG2804 Score: 179 E_value: 2e-14
PFAM Definition: No Hit Found
Swissprot: O74975|PCY1_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAA62YI19FM1
TTGGTTACCATATCATTTGAATCTAGGATCGTGCGGGATTACGAAAAATA
TATTATGCGACAGCTTCGTCGTGGTACCAGCCGCCAGGAACTCAATGTCT
CTTGGCTGAAGAAGAACGAACTAGATTTAAAACGACATGTCACAGAACTT
CGGGAGACCATCAAGAATAACTGGTCAACCACCGGCCGGGAACTGAGGGA
CGAATTCCGTAACTACTGGGCCCCCTCGCCCAGACCGTCTTCACCCTACC
AATTCGGGGCCTCTAATGGTGGTTCGAAGGACACCCTTTCACCACAGCAT
GAGAGGAATAATCCAACGTTGATGCATCTTGAGCCTCCTTCCCGGCCCCA
GTCACCTCATACCGAGTTTGCCAATGGGTATTCATTGGGCCTTATCGGAG
GTGTTAGATCTTGGATGCGATCAAGAGCAACTCCCCGTGGATCAATGGCA
GCTTCAGAAGCCTCCTCTGACGACGAAGACGTAGAAAGCCCGGATGAGGG
GAAATCGAAGAATGGCGAGGAAGATCTCATTCAGAGCGAATTGAACAGGG
TGGTTGGCAATAATGTAACCATCACTGCCGATAAGGCCTCTC

Sequences in the Contig:

SY0AAA62YI19FM1