Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA62YI07FM1
Length(NT) : 409
Best Gene Model Blast : Link to GSTUMT00006718001 E-value : 1e-141
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_06360
Accession: ref|XP_001796734.1| Score: 180 E_value: 3e-12
KEGG Definition: hypothetical protein
Accession: fgr:FG00172.1 Score: 155 E_value: 1e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA62YI07FM1
TTGGACGCAAACGAGTGCGTCGACGTTATCGAGAAGCAATTGGCGCCGTT
GCTGGCGGACGCTAAGCCCTTCTTTGGCGGGAGCTCCAGGCTCACGCTTG
CGGAGGTGCTTACTGCTTCGTTCGTCGTTAGATTGTATACATACGCGAAG
CCTGGGGTTGACTTTTTCCCCCAGGAGGCGATAGAGATGATCAGGAAGAT
TGGGAATTGGCAAAAGTGGGCGGACGCCTTGCTCGCTCATGAGAGTGTTA
TGGCGCAACCAGTCTATGGCACCGCATGGATGGCCCCACCAAAATACACT
CATGAGAGTGTTATGGCGATTTATGTGGAGAAGTAAAGGATGGACTATGT
GATTTTGGAGGTATTGGGAATAGAATCTAACTTAGGACAGAAATTGAAAA
TTTCAGTTG

Sequences in the Contig:

SY0AAA62YI07FM1