Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA62YH13FM1
Length(NT) : 546
Best Gene Model Blast : Link to GSTUMT00001791001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An07g02150
Accession: ref|XP_001391301.1| Score: 521 E_value: 1e-51
KEGG Definition: hypothetical protein
Accession: ang:An07g02150 Score: 521 E_value: 7e-52
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA62YH13FM1
TTGGGGACCATGTAATATGTAGGAAGAGAAGGAAAAAACAGGAAAAGGGG
CATTTTATGTGGTCACTGAACAAGAAGCGAATGATAAGTCAATGAGGGTG
GAGGCCCTGCCAGAGGACGGTGATGAAGAGGCGGAGCCTGTGTTCACTGA
CGATGAACTTCTTACTGCTTCACCAGTCGTGCTTGGATGGTCATTCAATG
AAAAGCTCTGGTTGGAATTCACTGTTTCCGGAGTTGAGGAAATTCAGTGG
AACGAAAAGGCTTTTGATTCCCTTGTGCTTGCCGAGGAGCAAAAAGAGAT
CGTCAAGGCATTGGTCGAATCGCACTCTGGTAATAACATCGCATCTGCCA
CTATTGACGATGTTATCCAAGGCAAGGGTCGTGGATTGGTGTCGGTACTT
CACGGACCTCCGGGTGTGGGAAAGACTTTAACCGCTGAAGGAATTGCCGA
ACTTTTGAAGAAACCCCTGTACTGTGTTTCTTCGGGAGAGTTGGGAACCA
ACCCTGCAGTTCTTGAGCACGAACTTAACAAGATCTTGGACATTGC

Sequences in the Contig:

SY0AAA62YH13FM1