Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA62YD23FM1
Length(NT) : 439
Best Gene Model Blast : Link to GSTUMT00008408001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_05372
Accession: ref|XP_001221467.1| Score: 177 E_value: 7e-12
KEGG Definition: ankyrin repeat
Accession: aor:AO090113000090 Score: 176 E_value: 4e-12
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA62YD23FM1
TTGGATTATCGTTACCGGTATCAAAGAGCGCGTTCAATTCCTGCGTCGAG
CTCGGCAAAACCCAACTTCCCGCAATTCAACACTCAATCGATTAGTGAGA
TGGGCAATCTGTTGTCACGATATATTCAAGGTGATTATAGCGGCAATGCT
GGTGATAATAATATCTTCGGCTCTAGTATCACCAACAATTATTGCAACCA
CGGGGACAGAAACCTGCCCGAGAACTACGACAATATTTTGCAACAACTAT
ACCCACCCGGATCTGGGTACAAGTCTCACCAAAATCGTGTTCCGAAGCCG
GCCAAAGGGACGTGCACCTGGGTTACGGATCATGAAAAGTATAAGGAGTG
GTTGGAAAATAAAACATCCGGCCTCCTCTGGCTATCCGCGGATCCGGGGT
GCGGAAAATCGGTCATCGCTTCATTCCTAGTGGAGCATC

Sequences in the Contig:

SY0AAA62YD23FM1