Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA62YD08FM1
Length(NT) : 159
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001223166.1| Score: 126 E_value: 6e-06
KEGG Definition: hypothetical protein
Accession: fgr:FG05322.1 Score: 123 E_value: 6e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA62YD08FM1
GGAACCTAAGAGGATGTTTTATGGCTTGTTCTGACTGAATTCCAAGGCCG
GTTTCTGCGGGGTAATGAAGTTCATGTGATGGCTGCTTAGTTGCCTGGTA
CTCCGGCTGAGCGATAGGATGTGATCAAATCCGACTATGGTGCTTACCAA
GCGGCTAAC

Sequences in the Contig:

SY0AAA62YD08FM1