Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA62YB23FM1
Length(NT) : 572
Best Gene Model Blast : Link to GSTUMT00000200001 E-value : 5e-56
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE56422.1| Score: 157 E_value: 2e-09
KEGG Definition: oxysterol-binding protein
Accession: aor:AO090005001507 Score: 157 E_value: 1e-09
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG2210 Score: 147 E_value: 1e-10
PFAM Definition: Oxysterol_BP, Oxysterol-binding protein..
Pfam Number: pfam01237 Score: 138 E_value: 1e-09
Swissprot: P38755|OSH7_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005625 = Cellular component: soluble fraction
GO:0005498 = Molecular function: sterol carrier activity
GO:0006897 = Biological process: endocytosis
GO:0006887 = Biological process: exocytosis
GO:0045324 = Biological process: late endosome to vacuole transport
GO:0030011 = Biological process: maintenance of cell polarity
GO:0016125 = Biological process: sterol metabolic process
GO:0015918 = Biological process: sterol transport

Sequence:
>SY0AAA62YB23FM1
TTGGAGATCGTTCGCGAGAGTCATCAGTACGTATCCCTGGTCTTGTCACA
GTCCCAAAGTTATCGTCTACAGTATGCCAAGACGGGAATACTTAACCCGG
ATGCTTGTCGCTGCCTATCAAGTTGCTATTTTCTAGGACTAATTACGCTC
CTATTTACACAAGGGACAATCACTGGTACGTTGAAATCGGAAGTGGAAGA
TTGAGAGAAGAAAAGAACGAGGAAAAGCATCAAATCAAACATGTTTGGGC
ACAATCCAATTACTAGTCATTCACATAGCCGACAAAGATCCTCCTTGTCG
AGCAACAAATCGGGTGATGGCGATAGGGCCGATTCCGAGGAGGAGACTGT
GGTGGACGATGGGGAGAAGAACAGTATGTGATCAAGCAGCCATGGATGTT
GTTGAGTTCTGGCGGGTTCAAGGTGGTGAAATCCATGCGGGGGTGCTAAT
CGAAATGCTCCAGTGCTACTCTCGATAATATCACAGCTTCGACCGGGTGC
AGACTTGAGCCGAATTACACTACCGACCTTCATCTTGGAGCCGAAGAGTA
TGTTGGAGAGAATCACAAACTT

Sequences in the Contig:

SY0AAA62YB23FM1