Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YO16FM1
Length(NT) : 505
Best Gene Model Blast : Link to GSTUMT00001089001 E-value : 9e-79
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 223 E_value: 4e-17
KEGG Definition: hypothetical protein
Accession: ang:An02g10560 Score: 218 E_value: 8e-17
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 172 E_value: 1e-13
PFAM Definition: No Hit Found
Swissprot: Q92625|ANKS1_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAA61YO16FM1
TTGGACCAGGAAAGCCAAATGCCTTGGAAACACTACCAGCCGATCCAATG
AATGTCCCCTGTTCGGCTATCCGCTTGTGCATCCAGGTGAATGGACAAGG
AGGACTACGACGTTTGATGTGGCGTATGCAGCTCTCGGGAAAGCTGTTTA
AAAGATGGAACTCCAGAACAAAGGTTACTCCTGGTGGTTTCAGAGGGGTT
CTTGGCTAAGTTAGGCCATGCTGAGATCAGTAGGATGGTATAGTAATATA
ACGAACGGAGAAGGCCTAGACACCGCTCTCACATGCTACTGCCTGTGGAC
ATGAGGAAGTGGTGAAAATACTGCTCGGGCGGGAAGAGGTCAACCCCGAC
AAGCCGGACAATGACGGCCAAACACCGCTCTCGCTCGCTGCTTGGTTTGG
ACATGAGGAAGTGGTGAGAATACTGCTCGGGCGGGAGGATGTTAATCCCA
ACGAGCCAGATAATGACGGCCAAACACCGCTCTCGAATGCTGCTTGGAGG
GGGTA

Sequences in the Contig:

SY0AAA61YO16FM1