Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YO14FM1
Length(NT) : 449
Best Gene Model Blast : Link to GSTUMT00008698001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_00305
Accession: ref|XP_001598219.1| Score: 372 E_value: 2e-34
KEGG Definition: homoserine kinase, putative [EC:2.7.1.39]; K00872 homoserine kinase
Accession: mgr:MGG_09550 Score: 307 E_value: 3e-27
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG1537 Score: 320 E_value: 6e-31
PFAM Definition: No Hit Found
Swissprot: P17423|KHSE_YEAST
Gene Ontology:
GO:0004413 = Molecular function: homoserine kinase activity
GO:0042802 = Molecular function: identical protein binding
GO:0009092 = Biological process: homoserine metabolic process
GO:0006549 = Biological process: isoleucine metabolic process
GO:0006555 = Biological process: methionine metabolic process
GO:0006566 = Biological process: threonine metabolic process

Sequence:
>SY0AAA61YO14FM1
TTGGGAACTCCATAACACAGGGGTACAGGAACATCTGCGCTCTCACCACA
CATACCACAGGCAGAGGGGTAGAGGGAAGGATTTCCAAAATGATTACTAT
CAAGGTTCCCTGTTCTTCCGCAAACATCGGTCCCGGCTTCGATGTTGTTG
GCCTCTCACTCTCCATCTGGCTAACTCTCCAGGTCAACATTGTTACCACT
ACCACCACCACCGATACAACTCCCCCCCCACACACCCTAAACTGCAACAT
CACTTACGAGGGCGAAGGCGCTTCTCACGTCCCGCTAGCTGCCGACGCAA
ACCTCATAACCCGCACAGCACTATACGTCCTCAAATGTCACGGCCAACGC
ACATTCCCGCGGACTACGCATGTCCACATCGTCAACCCCATCCCACTCGG
TCGCGGTTTGGGCTCTTCAGGCGCTGCAGTCGTAGCAGGCGTTCTCCTC

Sequences in the Contig:

SY0AAA61YO14FM1