Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YN23FM1
Length(NT) : 547
Best Gene Model Blast : Link to GSTUMT00002497001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_08185
Accession: ref|XP_001241022.1| Score: 369 E_value: 6e-34
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_2G11400 Score: 299 E_value: 4e-26
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA61YN23FM1
TTGGCAAACACTGTTGCGGCGAAGCTGGTTCTTGTACTGAGAGATTGACG
TGAAGGGCGCGGGCTGACCAAAAGGGTGTTCTTAGGGTACTGAAACCAGG
GGGATGGCTACAAATGATAGAAATTTATCACAACGTGCAGTCAGATAACG
GAACTATGACGGATAGGCACGCACTTCGAGAACTGAGCACAAAATTCCTA
TCGGCATCAGAGAACTCAAAGGATCTTCGTGCACCATTGGCGCTAGAGTC
CTTCATGCGGGATGTTGGGATGGTGGATGTGGCAGGCAGAATGATCCCGC
TGCCGTTAAATGGGTGGTCGATGAACCCCAAGGAGCGTGAAATCGGCGAA
AGGTTCAACTATTCGTACAAAGCAGCCATGAGTGGTCATATGCGCATTCC
TCTCACCGAGAGACTCCATTTGACCCACAGCCAGTTCAACGACCTGATAC
AAAGAGCCACAGAAGAACTGGACAACCTCGGTTTGAAGCCATACGTTGGA
TTATATATTTGCATCGGTCGCAAAACATATTAAACATAACACAGGGG

Sequences in the Contig:

SY0AAA61YN23FM1