Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YN02FM1
Length(NT) : 313
Best Gene Model Blast : Link to GSTUMT00004940001 E-value : 1e-178
Numbers of ESTs : 1

Blast Results:

Nr Definition: leucine-rich repeat protein SOG2 (predicted)
Accession: ref|NP_596483.1| Score: 284 E_value: 3e-24
KEGG Definition: hypothetical protein
Accession: spo:SPBC887.09c Score: 284 E_value: 1e-24
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0532 Score: 181 E_value: 4e-15
PFAM Definition: No Hit Found
Swissprot: O94294|SOG2_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0051286 = Cellular component: cell tip
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAA61YN02FM1
TTGACTTCATTCTCGGAGGAATTCTCAAGTTTACCTCGCCTTCGATATTT
AAACCTCCGATCCAATTTTCTCAGAGAGTTCCCGTTGCCACTCACCAAAC
TGCCTTCACTTGAGATACTAGATGTTAGCCGAAATCGGCTACGATCGCTG
CCGCAGGATTTTGGGAAGCTGATGTCTTTAAAGGTCCTGTCAATGTCGAA
GAACAAGATCAATGTGCTGCCAACATATATAGGGGACATGAACGAGCTCA
AGATACTAAAGCTAGATCACAACCCCATACTATTTCCAGCAAAGGATGTT
CTGGAAAATGGGG

Sequences in the Contig:

SY0AAA61YN02FM1