Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YM02FM1
Length(NT) : 494
Best Gene Model Blast : Link to GSTUMT00003213001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: glycerol-3-phosphate dehydrogenase, mitochondrial
Accession: ref|XP_001264887.1| Score: 194 E_value: 8e-14
KEGG Definition: glycerol-3-phosphate dehydrogenase, mitochondrial [EC:1.1.99.5]; K00111 glycerol-3-phosphate dehydrogenase
Accession: afm:AFUA_1G08810 Score: 194 E_value: 4e-14
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0042 Score: 191 E_value: 6e-16
PFAM Definition: DAO, FAD dependent oxidoreductase. This family includes various FAD dependent oxidoreductases: Glycerol-3-phosphate dehydrogenase EC:1.1.99.5, Sarcosine oxidase beta subunit EC:1.5.3.1, D-alanine oxidase EC:1.4.99.1, D-aspartate oxidase EC:1.4.3.1..
Pfam Number: pfam01266 Score: 108 E_value: 3e-06
Swissprot: P90795|GPDM_CAEEL

Sequence:
>SY0AAA61YM02FM1
TTGGCAAAAACTCACGAAGCCATAAGCAATAGTCCGTCGCCCTCGATCCT
TTTTTACCCCCTCCCGTTTTCTTTTCCGTCCCCCGCCCTTCTCCATTCGT
CTGCCAGTCCTCTCTTCTTTATCGTCTGTCAAACCCAATGGCCGGAGCTC
GCTCCTCAATGGGCTCTCTTAGGAGACCCTTTCTTATTGGAACAACCGTG
GCTGTTGGTGGCTTTGTTGCCTACAAGTCATACTCACCTCGCCCCGCTTC
TCACACATACTCTGTCGGGAAAGATCGCGACACTGCTTCTACGGATGGGC
GTCCGAACGTGATGGGTCGTGTTCCTGCGCCTCCAAAATTTCCGCCCCTA
CCAACCAGAGAGGAACAGATCAATCGCCTGCGAGCTGGGACAGAGGGAAG
TGGGTACGATTTGTTGGTCATTGGAGGTGGTGCTACAGGTAGTGGAATTG
CTCTGGATGCTGCTAGTCGTGGCCTCAAGGTGGCGATGGTGGAG

Sequences in the Contig:

SY0AAA61YM02FM1