Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YL05FM1
Length(NT) : 631
Best Gene Model Blast : Link to GSTUMT00004514001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_11456
Accession: ref|XP_001587464.1| Score: 526 E_value: 5e-52
KEGG Definition: DEAD/DEAH box RNA helicase (Ski2), putative
Accession: afm:AFUA_2G10000 Score: 447 E_value: 4e-43
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0947 Score: 263 E_value: 5e-24
PFAM Definition: No Hit Found
Swissprot: O59801|YJV3_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAA61YL05FM1
TTGGCGATAGAAAAACGTCTTTAGTATATTAAAGGCCAGTAGCGCTTCTA
CAATGGCCTCTTCTGAGAGCCTCGCGGATGCCATTAACCAGCTGTCCCTA
GTTGATTTCGACAAGTCTGATGGATGGATCGAGGATATACTAAACCAACA
ACTGCCCCGTAAACGGGTTAAGCCTGATCAATCTCAGCTTCGAGAGCAGC
TTCAACAGGAGTTTCTTACACCCTCTCCGGTGTTTTCCACCGAGTGGCTA
AATAAGCTTCAGAAACGATGGGACGACCCACCCGACTACGTTTCCCTTAT
GGGCCTCGCCCCTTCGATGTCTCGTACTGTTATCCGGTTCACCCGCGAGG
GTCTCGAAGGTCGTGTCACTGGCTACAAGGAGGTTACGGTTCCTGCTCAC
TCAATTACTGCAAAGAACTCCACCTCGCTATTAAGAAAACCTGCTTCAAA
GGCAGATTTCGTAAGAGGCAAGGCAGGTTTTTTTCCATTTAGTCCCGGCG
GAGTCGATATCGGAGCTGCGAACGAAAGACCCGAGGAGTTGGAGCTCCAG
GAGGCCCTGATGGAGGAAAAGATCGGCAAGAATGGACTACTGAGGGTTGC
GCCGGGTATGGCGCGCGGGCTGATATTTGAT

Sequences in the Contig:

SY0AAA61YL05FM1