Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YK24FM1
Length(NT) : 585
Best Gene Model Blast : Link to GSTUMT00002266001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_05548
Accession: ref|XP_001555873.1| Score: 244 E_value: 2e-19
KEGG Definition: ankyrin repeat
Accession: aor:AO090001000528 Score: 236 E_value: 9e-19
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA61YK24FM1
TTGGATCGCAGATGAAGTACGGAAATATTTCCCTGAAACTTCAGAGATGT
TGCAGATAGACGCCCGCGCGGGTGACATCGGGTTATACCTTAGGGCCAGG
TTGGATGGAGACCCGGAGTTCGGCGCAATGAACGAGGAATTGCGGGATGA
TATACTCAAAGTTATTCCGGAAAAGATCTCGGCGATATTTCTTCTCGTTC
GTATTAATATGGATGCAATCATTGCCGAGCCGACAATCCATAGGAGAAGA
CAAGTACTCGATAGGATGACCGATGGCCGTGGTTTAGAGGATGCATACAG
CGCGACATTGGAGCGTATAAGACTGCAGAGGGAAAGTAAAGCGGGGCTGG
GAATGCAGGCGCTGATGTGGATTTATCATTGCGAGCGGCCATTGAGCCCA
GATGAGCTATGCAATGCGCTGGGAGTAGAATTGGGGACTGAAGACTTTAT
CATAGACAACGTACCTTCGTGGCAGACGGTACTGGGCAGCACATTAGGAC
TTGTTACAGTAGGCGAAGAGGATTCAAAGGTCCGTCTCCTCCATCTCACA
CTTAAAGAGTATCTTGGAGAACATCCCACCCTGTT

Sequences in the Contig:

SY0AAA61YK24FM1