Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YK22FM1
Length(NT) : 604
Best Gene Model Blast : Link to GSTUMT00005280001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001216613.1| Score: 446 E_value: 9e-43
KEGG Definition: hypothetical protein
Accession: ang:An09g06650 Score: 433 E_value: 1e-41
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG2583 Score: 206 E_value: 2e-17
PFAM Definition: No Hit Found
Swissprot: O60044|QCR2_NEUCR

Sequence:
>SY0AAA61YK22FM1
TTGGCTCACCAGCAAGAGCATTACCGAGTACTCTAAAGAGGTGTATAACA
AGGGCAATATCGCAGTTGTTGCCTCCGGTGCTCCTCAACTGGATCTTGAG
AGGTGGACAGCCGAGTTCTTCAAGGAACTCCCCTCTGGAACTGGACCAGT
CATGGCTCCCGCTAAATACTACGGAGGTGAGAACCGCCTATTCTCGCCAC
ACGGCAATGCCATAGTCATTGCCTTCCCTGGTAGTTCCAGCCCTCCATCT
TTCAAAGCAGAGTATACTGTTCTGGCATACCTACTCGGTGGAGAGGCCTC
TACCAAATGGAACGCCGGAATGTCACTCTTGTCCCAAGCAATTTCTGAGA
CCCCTCACACCACTGCCGTCGCCAAGCACGTTGCATACACTGACACCGGT
CTCCTGTACATCACCATCGAGGGCTCTGGATCTGCAGTGACTCAGGCCGG
GGGTAATGTTGTGAGCGCTATCAAGAGTCTGGGAGAGGCCAAGCCCGAGG
ATGTCAAGAGGGCCATTGCCCTCGCGAAGTTCGACGTCCTTGCCGCCGCA
GAAGACAGGAGTGCTGGTCTAGAAGCCGTTGGACAGGCTGTCATTGCTAG
GGGA

Sequences in the Contig:

SY0AAA61YK22FM1