Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YK21FM1
Length(NT) : 587
Best Gene Model Blast : Link to GSTUMT00007223001 E-value : 2e-58
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 365 E_value: 2e-33
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 361 E_value: 3e-33
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 264 E_value: 3e-24
PFAM Definition: No Hit Found
Swissprot: Q8UVC3|INVS_CHICK

Sequence:
>SY0AAA61YK21FM1
TTGGGTCTCCCACAATATCCTACCTGAGCAGCAAATAAAGGGAAATGTTT
GAATTTTTTGGTAATAATACCAACCCCTTTAACGGGCGCCACGGAACACC
TCTCTGGTATGCTGCTATGAATGGGCATAAGGAAGTGGTGGAAATGCTAC
CCGGACGGCGAGATGTCAACCCCAATAAAGCAGATGAGGACGGCCGAACA
CCACTCTTTTGTGCTGCTAAGAATGGGCACGAAGAAGTTGTGAACATGCT
GCTCGGACGGGGAGACGTCAACCCCAGCACACTTGACGAATTAGGCCAAA
CACCACTCCATTATGCTGCTTGGAGTGGGCGTAAGGGAGTGGCGAAGATC
CTACTCGGACGAGGCGATGTCAACCCCAACGTACCAGATGACGACGGCAG
GACACCGCTGCATTGTGCTGCGTGGAATCGGTATGGGGGAGTGGTAAAAG
CGCTACTCAGACGGGGCGACGTCAGCCCCGACGAACCAGACCAGGACGGC
CAAACACCACTCTGGTGGGCCTCTCGGAGCGGGCACGAGAGAGTGGTGAA
AAGACTTCTCGGACGAGGCGATGTCAACCCCAACTCA

Sequences in the Contig:

SY0AAA61YK21FM1