Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YK11FM1
Length(NT) : 630
Best Gene Model Blast : Link to GSTUMT00002980001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU00676
Accession: ref|XP_965816.2| Score: 238 E_value: 1e-18
KEGG Definition: hypothetical protein
Accession: ncr:NCU00676.1 Score: 238 E_value: 6e-19
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG3015 Score: 208 E_value: 1e-17
PFAM Definition: No Hit Found
Swissprot: P22135|ATP12_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0019904 = Molecular function: protein domain specific binding
GO:0033615 = Biological process: mitochondrial proton-transporting ATP synthase complex assembly

Sequence:
>SY0AAA61YK11FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTGCTCAGGGTGAAGCTGGA
ACCTTTCGGGAAGAACCGGGTGGGCGAAATGTTTGTGTTGCCTTAACTCG
ACGAAATTGGAAACACCGTGATTTTATCTCTTCGCTGCACTGTTCCTTTG
GTCGCCAATCAGCAAACGCAGATACGCGCACCCAAGAGCCCTATTGACAT
AACGGTAGTGGTATTGCGTGCTCATGCCGGAATTCTCGAGTACTCGTACT
CGAGTAATCACTTCACTAAGAAAACTCTGCATACGGGTGTCAAGAAGAGA
TTTACTTCTCGGCACCCAGGGCTATCAGCCAAGCAGCTCCCAACTGCCTC
TTTATATCCTCCTTGTCCACATCATGTGTATCTTCGACTTCTCCCCAGAT
CTCTGTCTGATACCTGACTTCGACGCTCGCGGCTCTAGCCGCCTCTTCAA
TCCCCCAACTCTTCTCTCCGACCCCAACGTCGGAACTCCACTCCGCTACC
AACCTCGCACCAATCAAGAAACTCTTGCTCGACATTGTGGCTATTTCCAG
TGCAACCAAATCCCAATCCGTCAATCCCTCCAACCATTCCCTTATAGCTT
TCACCGTCTCAGGCAGTTGGTGTGCGATGA

Sequences in the Contig:

SY0AAA61YK11FM1