Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YJ01FM1
Length(NT) : 433
Best Gene Model Blast : Link to GSTUMT00010272001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_13795
Accession: ref|XP_001803998.1| Score: 238 E_value: 6e-19
KEGG Definition: hypothetical protein
Accession: fgr:FG05499.1 Score: 217 E_value: 8e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA61YJ01FM1
TTGGGCCATCTAAAGGTGATATTGGAACGTCATCGATAATAGACGACCCA
TACGACTTTGTTACCCCTCGAGCCAGCAGCTCCGACCAATCCATCGCTTC
CACGGTAGCCCCATCGCATCTGCCCCGACTCTCTAGTGGTGCAACAACTT
TATCAACGGCATCATCAATAGTAACTCCTCGGTCTTCTGAGCTTTCCTCG
TCAAGCCGCACTGGAAGCCCTGCGCCGGGGAAGAAGTCAGCTTCCTACTC
TCTCGCCCGATCAGGCGGTGAGCAGCCTGACTTGTCGGCTCTTGCGACAC
ATATGCGAACTGCCGCCCAAATGCTGGCCCAGCTAGATGCCAGCAGTTCC
AAAACGCCGAAGAATGAGGTGGCAGCTATTAAGGCTAAAATTATTGCCAG
TATGCAAACCCTGGAGGAGCAGAGCTTCTTTTT

Sequences in the Contig:

SY0AAA61YJ01FM1